top of page
Search

Thai DENV1 to DENV4 specific Probes can also be identified based on Thai ZIKV Probe

  • Writer: Sarayoot Piboonnithikasem
    Sarayoot Piboonnithikasem
  • Jun 8, 2018
  • 1 min read

From Yesterday Post, Nucleic Acid Probe from Protein Tertiary Structure [https://sarayoots.wixsite.com/mysite-1/home/nucleic-acid-probe-from-protein-tertiary-structure], Nucleic Acid Probe can be designed and engineered easily from understanding of Protein Tertiary Structure and its Differences,for example, Thai ZIKA virus specific PROBE that was identified from its NS5 Protein using Biological Variations Detection and Monitoring System. Today, from that Thai ZIKV Probe, Thai DENV1 to DENV4 specific Probes can also be In silico identified by Alignment then Validated by BLAST, Those were; >ThDENV1-JQ922547 AAGCTGACCTACCAAAATAAGGTGGTAAGGGTGCAGAGACCAGCAAAAAATGGAACCGTGATGGATGCTATATCCAGACGTGACCAGAGAGGAAGTGGA >ThDENV2-FJ906958 AAACTAACGTACCAAAACAAGGTGGTGCGTGTGCAAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCAAGAAGAGACCAAAGAGGTAGTGGG >ThDENV3-DQ863638 AAGCTCACATACCAAAACAAAGTGGTCAAAGTTCAACGACCAACTCCAAAAGGCACGGTAATGGACATCATATCTAGGAAAGACCAAAGAGGCAGTGGA >ThDENV4-AY618993 AAACTAACCTATCAAAACAAAGTGGTGAAAGTCCTCAGACCCACACCGAAAGGAGCGGTAATGGACATTATATCCAGGAAAGACCAAAGAGGTAGTGGA Moreover, ALL 4 THAI DENVs specific Probes were not FOUND in ZIKV Genomes.


 
 
 

Comentários


bottom of page